User Manual

Primer design

Primer design is divided into user input area and parameter setting area. To get primer design results, you need to submit at least the items in the user input area.

User inputs

• [ required ] Template sequence file in fasta format

  For the description line of each sequence in fasta (beginning with the > symbol), we use the "|" symbol to separate different sequence attributes. The described sequence attributes include the name of the molecular marker and the position of the molecular marker. In addition, we recommend that each fasta sequence be longer than 600bp for better primer design results.

  Describe line template: > marker_name | marker_area

  • marker_name The name of the molecular marker, it is recommended to use English letters and Arabic numerals, and avoid spaces and irregular characters.

  • marker_position To ensure the sequencing quality of the mutated sequence, the targeted sites were within 150nt of the forward or within 118nt of the reverse target-specific primers. The bases on the sequence are counted from 1, including two ways of writing:

    1. The position of the single nucleotide in the sequence. For example, 348 means that the 348th base on the next line of sequence is a molecular marker, and this expression is only applicable to single-nucleotide polymorphism (Single-Nucleotide Polymorphism, SNP).
    2. When the length of molecular markers is greater than or equal to 1 (such as InDel and so on), the start and end positions of the markers are separated by "-" symbols. Such as 301-304, which means that the 4 bases in the range of 301 to 304 bases on the next line of sequence are molecular markers, and for SNP markers, there are also equivalent expressions, such as 348-348, which is consistent with the first way of writing. Therefore, this form of expression is suitable for most molecular markers.

  Data Format

  >marker1|301 TTTGCCACTTAAACGTTGGCTCCTTGACTGTGTCATGTGTCCATGTGTGTCGATTCTGAAAGATTCCTTCTCCTTGGGTGTTCAGTTTCTTGATTGATGAAAATTGCCTGGCTAACTAATCTGTGTTTCCTCGCCAGGCAATTGCGCTCTGCCCCGACGTCGCCGTCTACTGGATCAATCGGGCCCTGTGCCATTTCAAGCGCAAGTGAGCGACTTTACTTTTTGTTGCCTCCCTTCCTGGCAAGAAAGAAACAAACGTCTGGAATAGTAATCTTTGTGCACAGGGAGTGGGCCAAGGTCGAAGAGGACAGCAGGAGGGCTCTTGCGCTTGATTACACTTTAGTCAAGGTCACATTCTTGTTTCTTCTTTCGTCTCAAAACTAAAGCGCCGACTTCAGTTACCTCTACATTATGTAATCGCTATTCTTAACTAACCGTTTGACACCAATAAAGATACAAAAGTAAGTAGCCGTGATTATTCCGTTCCTTGTGTGATGTAGGGGCACTATCTGCTGGGGTGTGCGCTACTCGAGAAGGAAGAATCTGCTCTTGCTATCAAGGAATTCGAAAAGGTTTACCTCAACCGTTTGTCTCTTGCACG

  >marker2|301-304

  TGCTCGGATGTGACTGAGTGACGACGATCACGGTGCAGTTTCTTGTCAATTCTTCGGGTCGAATGCTCGCAGCAGACGACTGAGGCCGTGATCAAGCGGTGGACGACGGTGACGGAGATCATAGGGAAGGCCATGGTCGCCATGCGGAGGCAGCTGTACGCGCAGAACCCAGGCGCCTTCGACGGTTTCAGGGACGAATACTTGCTGGCCATCGCGGAGAACCGCATCCTGATCCTGCTCGACTTCGCCAACGGATTCACCAGCATCACGTCGCACGAGAAGCTCGTGTACATGCTCGGCATGTACGAGGCTCTCACCGACGCCGCTCCCAGCCTCCTGCTCCTCCTCAGCGGCGCGCGCAAGGAGGCCATCTCGGAGCGGACACAAGGTATCCTCACGAAACTGGCCGGCGCGGTGAGGATCATGGTCAGCGGCGCCATAGCCAAGATCCAAGGCGACTCACTGTTCCCGCACACGCCGAGCGCCGCAGGTGGCGTCCACCCGCTGACACGCAACGCCATGACCTGCGTCGAGCTGCTGGCGAGGCACCGCACCACGCTCGATCTGATCCTCGCGGGCGCCGACGAGCGCAGCTCCCTCGCC

  >marker3|348-348

  ATTATATCCCAAGTGAACCTAAAAGTTCTCCCACACAACGACGCAGGGTTTTACAAACAACCACCAAGGGCATGTTGTGGCGCGCCTGGGAGGGGTCCTTACAATTTCAACCTGACAGCGAAGTGCGGTGAGCCTGGTGCCTCGGCTTGCGCTGATCCTAAGACGCACTGGAGCTGGGATGGTATTCACTTGACAGAAGCCGCGTATCTGCACATTGCCAGAGGCTGGCTTCATGGACCGTTCGCAGACCAGCCTGTTGTACAAGCATCTTGAGTAATGTTGTGGCGCGCCTGGGAGGGGTCCTTACAATTTCAACCTGACAGCGAAGTGCGGTGAGCCTGGTGCCTCGGCTTGCGCTGATCCTAAGACGCACTGGAGCTGGGATGGTATTCACTTGACAGAAGCCGCGTATCTGCACATTGCCAGAGGCTGGCTTCATGGACCGTTCGCAGACCAGCCTGTTGTACAAGAGGGCATGTTGTGGCGCGCCTGGGAGGGGTCCTTACAATTTCAACCTGACAGCGAAGTGCGGTGAGCCTGGTGCCTCGGCTTGCGCTGATCCTAAGACGCACTGGAGCTGGGATGGTATTCACTTGATGAGTACAGTACACCCAGCCTCTCCTCCCTGCTGTTCTTGCACCTCTAGAGTGAGTGGCCACAATAGCACACACCGTGCGTGACACCAAACTGGATCCGATAAGGTA

  Note

  If there is a fasta sequence that does not conform to the agreed format, the primer design result for this sequence will not be output, and it will jump to the next sequence to try to design a primer.

Default settings

Default parameters include minimum, optimum, and maximum values for primer length, PCR product length, and T_m value. All sequences in the fasta file submitted at the same time use this set of parameters to design primers in batches. In the design process, these 9 parameters will be used for sequence design of conventional primers, and specific sequences will be added to the returned primer sequences.

Result

The result page only presents the primer design results of the first sequence on the page, and you need to download all the primer design results by clicking the "Download all primers" button at the bottom of the results page.

You need to click the "Download all primers" button at the bottom of the results page to download all the primer design results.

Header

Marker Name, Left Primer Sequence, Right Primer Sequence, Left Primer 5' Start Site, Right Primer 5' Start Site, Left Primer Length, Right Primer Length, Left Primer T_m Value, Right Primer T_m Value, Left Primer Primer GC Content, Right Primer GC Content, Product Length

iBP-seq

According to different application directions, iBP-seq can be divided into iBP-genotyping method for genotyping and iBP-epigenotyping method for methylation level detection.

Genotyping

Submit a task

You can directly click the demo button on the submit page to run the preset example. Of course, you can also submit the following information required for iBP-genotyping analysis yourself.

• [ optional ] Reference genome

  You can select an existing reference genome from the drop-down box, or upload reference sequence by yourself.

• [ required ] Barcode info

  The barcode sequences you used in your experiment, they are all 8bp in length. Each line of barcode sequence corresponds to one sample.

• [ required ] Mutation info

  Variation information for molecular markers (SNP or InDel).

  Data Format

  CHROM	Pos	REF	ALT
  7	131102379	C	G
  3	14591067	C	CGGAGGA
  zong31	28	GCCG	GCCGGA
  zong31	33	ATGCACCG	A

  Note

  Here zong31 is the name of the custom reference sequence, this example is just to show the variety of optional mutation information formats, including SNP, Insert, Deletion and complex mutations, can be used for genotyping detection.

• [ required ] Fastq file

  Paired-end fastq files generated by next-generation sequencing. We prefer to upload files in .gz compressed format, which will further save your upload time.

• [ required ] Email address

  A valid email address to receive the analysis result.

Once the file upload is complete, you can leave the website and wait for an email notification of the result.

Result

The PNG image file helps you observe the genotyping results and efficiency from a macro perspective, and the xlsx file tells you the detailed information of each genotype.

• PNG

  Each picture corresponds to the genotype results of a population, and the title of the picture is also marked in the format (chromosome_locus_REF_ALT, the same as the content of the variation information file) for easy distinction. Each rug on the x-axis represents a sample, and its corresponding x-axis value represents the proportion of the mutated base at this site in the sequencing data (in short, $Valu{e}_x=\frac{Alt}{Ref+Alt}$$Value_x=\frac{Alt}{ Ref+Alt}$ ). A KDE (Kernel Density Estimation) plot constructed from these 1D data can distinguish different groups of genotypes. For the analysis of diploid populations, populations with x-axis values around 0.5 are heterozygotes, while populations with values closer to 0 or 1 are homozygotes of different types.

  

  Fig.5 Kernel density distribution of mutation base frequency in population samples (chr7; 131550047bp; Ref=C; Alt=T)

• XLSX

  The first column corresponds to a sample for each num in order. The second column corresponds to the allele frequency of the ALT base at that locus for each sample. The third column 0, 1, and 2 represent three different genotypes, corresponding to the three peaks from left to right on the KDE curve.

  Data Format

  Num	Frequency	Genotype
  ...	...	...
  6	0.057692	0
  7	0.909091	2
  8	0.45045	1
  ...	...	...

  Header

  Sample ID, Frequency of Alt Genotype, Sample Genotype

Epigenotyping

Submit a task

You can directly click the demo button on this page to run the preset example. Of course, you can also submit the following information required for iBP-epigenotyping analysis.

• [ required ] Barcode info

  Each row consists of the 8bp barcode sequence and the corresponding reference sequence name.

  Data Format ATCACGTT,B73/Mo17 CGATGTTT,B73 TTAGGCAT,Mo17 TGACCACT,W22 ACAGTGGT,SK GCCAATGT,B73/Mo17/SK/W22 TGGTTGTT,B73/Mo17 ...

  Format Description

  barcode sequence, reference sequence 1/reference sequence 2/... (barcode sequence and reference sequence are separated by "," and multiple reference sequences are separated by "/")

• [ required ] Reference genome

  You need to submit a fasta file containing multiple reference sequences for alignment.

  Data Format

  >1-B73 ATCCACGTCGCCAGAAATTCTTCACGCCGCTAGATTGTAAATCAATGGCTTCTATCCATCGTTGTATCGGTGGCGTGTGGAATGTCTCTTCTCACTCCTTCCGCTTCTCGAGACTTCCATGGTTGGCCCGTGCAGTGCATGCCTCTCCTCGCTCCCTTCGTCTCTCTGCCAGCTGCTTCACCTTCTGCCGCTTTGATCGTCCACTTCACTCCAGCACAGTCGCGTCGTCTACTGTCGCCTTCATCGTCTGCTTCGATGTTTGGTGATATCCATCACTTTCTTCATCGGCTCCACTTCCTCGTCGAGTTGCTGTTTCTTTCATTGGGGTTTCGAAGGGTGTGTTTGGTTGGATGTACATGGAGGGATGGAATAAGGTGGCCACATTTTCAATAGTGTTTGGA

  >1-Mo17

  ATCCACGTCGCCAGAAATTCTTCACGCCGCTAGATTGTAAATCAATGGCTTCTATCCATCGTTGTATCGGTGGCGTGTGGAATGTCTCTTCTCACTCCTTCCGCTTCTCGAGACTTCCATGGTTGGCCCGTGCAGTGCATGCCTCTCCTCGCTCCCTTCGTCTCTCTGCCAGCTGCTTCACCTTCTGCCGCTTTGATCGTCCACTTCACTCCAGCACAGTCGCGTCGTCTACTGTCGCCTTCATCGTCTGCTTCGATGTTTGGTGATATCCATCGCTTTCTTCATCGGCTCCACTTCCTCGTCGAGTTGCTGTTTCTTTCATTGGGGTTTCGAAGGGTGTGTTTGGTTGGATGTACATGGAGGGATGGAATAAGGTGGCCACATTTTCAATAGTGTTTGGA

  >1-SK

  ATCCACGTCGCCAGAAATTCTTCACACCGCTAGATTGTAAATCAATGACTTCTATCCATTGTTGTATCGGTGGCGTGTGGAATGTCTCTTCCCGCTCCTTCCACTTCTCGAGACTTCCATGGTTGGCCCATGCAGTGCATGCCTCTCCTCGCTCCCTTCGTCTCTCTGCCAGCTGCTTCACCTTCTGCCGCTTTGATCGTCCACTTCACTTCAGCACAGTCGCGTCGTCTACTGTCGCCTTCATCGTGTGCTTCGATGTTTGGTGATATCCATCGCTTTCTTCATCGGCTCCACTTCCTCGTCGAGTTGCTGCTTCTTTCATTGGGGTTTCGAAGGGTGTGTTTGGTTGGATGTACATGGAGGGATGAAATAACGTGGCCACATTTTTAATAGTGTTTGGA ...

• [ required ] Fastq file

  Paired-end fastq files generated by next-generation sequencing. We prefer to upload files in .gz compressed format, which will further save your upload time. You can also download a pair of complete demos from the website.

• [ required ] Email address

  A valid email address to receive the analysis result.

Once the file upload is complete, you can leave the site and wait for an email notification of the result.

Result

PNG image files help you observe the results and efficiency of epigenotyping from a macro perspective, and csv files tell you the detailed information of each individual genotype.

• PNG

  Results of three different methylation types corresponding to several reference sequences.

  

  Fig.7 Visualization results of different methylation types

• CSV

  Detailed information on the type of methylation at the corresponding position of each reference sequence.

  Data Format

  chr	pos	context	C_count	CT_count	ratio
  1-B73	68	CG	2662	3965	0.671375
  1-B73	86	CHH	714	3969	0.179894
  1-B73	128	CHG	1814	3969	0.457042

  Header

  Chromosome Name, Position, Methylation Type, The Number of C in NGS Reads, The Total Number of C and T in NGS Reads, The Ratio of the Number of C in NGS Reads to the Total Number of C and T

Copyright

Copyright (c) Li Lab of HZAU, All rights reserved.